Commit c8f45f84 authored by Lingling Jin (lij313)'s avatar Lingling Jin (lij313)
Browse files

03.21

parent 37c80916
#!/usr/bin/env python
from Bio import SeqIO
# ExPASy for obtaining records from ExPASy/Swiss-Prot
from Bio import ExPASy
from Bio import pairwise2
from Bio.pairwise2 import format_alignment
# get sequence 1
socketObj1 = ExPASy.get_sprot_raw( "P00740" )
proteinObj1 = SeqIO.read( socketObj1, "swiss" )
socketObj1.close()
# get sequence 2
socketObj2 = ExPASy.get_sprot_raw( "P00748" )
proteinObj2 = SeqIO.read( socketObj2, "swiss" )
socketObj2.close()
# show the information we've obtained
#print( proteinObj1.description )
#print( proteinObj1.seq )
#print( proteinObj2.description )
#print( proteinObj2.seq )
# finding alignments
alignments = pairwise2.align.globalxx(proteinObj1.seq, proteinObj2.seq)
# showing results
for alignment in alignments:
print(format_alignment(*alignment))
\ No newline at end of file
>441E-1189 wei8feb28/441E1189.SEQ trimmed vector-stripped
GCACTCCACCAGTAAAGAAGTGCAGGCAACTAGCTAGCTAACCATGGCCGCCTCTGCCTC
TTGCATTTCACTGGTGGTGCTCGTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTCGCC
GACGTTCTACGACACGTCGTGCCCCAGGGCCCTGGCCACCATCAAGAGCGGCGTCATGGC
CGCCGTGAGCAGCGACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGACTG
CTTCGTCCAAGGCTGTGACGCGTCTGTTCTGCTGTCTGGCATGGAACAAAACGCTCTCCC
GAACAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGAGGC
CATCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACTCCGT
CGTCGCCCTCGGAGGGCCATCATGGACAGTCCCTCTGGGAAGAAGGGATTCCATAGATGC
AAACGAGGCGGCGGCAAACANCGACCTCCCANGCCCTACGTCTANCCGTTCAGATCTTGA
NCTGGCATTCAGCAACAAGGGCCTCCTTACGGNCGACATGGTGGNCCTCTCCGGCGGCGC
ANACCATCNGNCAAGGCGCANTGNCGGGNANCTTNAAAGGACAAGGATCTTACAAATGGA
GACCCAANATTCGACCNACNAACCTTCNGCCCAANTTCTTNTTCCGGGGCCAAAATTGGC
CCCCCGG
>441E-1197 wei8feb28/441E1197.SEQ trimmed vector-stripped
GCACCACTCCACCAGTAAAGAAGTGCAGGCAACTAGCTAGCTAACCATGGCCGCCTCTGC
CTCTTGCATTTCACTGGTGGTGCTCGTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTC
GCCGACGTTCTACGACACGTCGTGCCCCAGGGCCCTGGCCACCATCAAGAGCGGCGTCAT
GGCCGCCGTGAGCAGCGACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGA
CTGCTTCGTCCAAGGCTGTGACGCGTCTGTTCTGCTGTCTGGCATGGAACAAAACGCTCT
CCCGAACAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGA
GGCCATCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACTC
CGTCGTCGCCCTCGGAGGGCCATCATGGACAGTCCCTCTGGGAAGAAGGGATTCCATANA
TGNAAACGAGGNGGTGGCAAACAGCGACTCCCAGCCCTACGTCTAGCCGTTCAGATCTTG
AG
>441E-186 Oct_13-2001/RH101257.SEQ trimmed vector-stripped [poly-A tail removed]
GAGGCAACTAGCTAGCTAACCATGGCCGCCTCTGCCTCTTGCATTTCACTGGTGGTGCTC
GTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTCGCCGACGTTCTACGACACGTCGTGC
CCCAGGGCCCTGGCCACCATCAAGAGCGGCGTCATGGCCGCCGTGAGCAGCGACCCTCGG
ATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGACTGCTTCGTCCAAGGCTGTGACGCG
TCTGTTCTGCTGTCTGGCATGGAACAAAACGCTCTCCCGAACAACGGGTCACTGCGGGGC
TTCGGCGTCATCGACAGCATCAAGACACAGATCGAGGCCATCTGCGCCCAGACCGTCTCC
TGCGCCGACATCCTCACCGTCGCTGCCCGTGACTCCGTCGTCGCCCTCGGAGGGCCATCA
TGGACAGTCCCTCTGGGAAGAAGGGATTCCATAGATGCAAACGAGGCGGCGGCAAACAGC
GACCTCCCAGGCCCTACGTCTAGCCGTTCAGATCTTGAGCTGGCATTCAGCAACAAGGGC
CTCCTTACGGTCGACATGGTGGCCCTCTCCGGCGCGCACACCATCGGCCAGGCGCAGTGC
GGGACCTTCAAGGACAGGATCTACAAATGGAGACCAAACATCGACACGACCTTCGCCCAC
ATTCTTCTTCCGGGGCCAAACTGGCCCCCCGGGTNCCGGGCGGGCGGAACGGGCAACCCT
GGGGGGAAACCTGGGAACACGAACGNACNGGGCCCAAACAACCNTTTCCGAACCAAAACG
GCCCCTTAACTTAACAACCCNAAACCCTTCCCATTGGGTTCANCAAANAAAANGGGGGGC
NTTCCCTNGGCCACCTCCGGGGAAACCCAGGGGGGGGCTTGGNTTNCAAAACCAAAACGG
AAACCANCCCCCCCCCGGAAACAAAANNACCGGGGTNNCCCGGGGNAAAACTTTTTTGGG
GGGTNCCAAAAAACCCCCGGGGCCCGNGNAATTTTTTAANNNAAAGGGGGGGCCCNTTTT
TNNCCGNAAAGNGGGGGCCCCATTTTGGATTTCC
>441E-1086 Oct_25-2001/RH102623.Seq trimmed vector-stripped
GAAGAAGTGCAGGCAACTAGCTAGCTAACCATGGCCGCCTCTGCCTCTTGCATTTCACTG
GTGGTGCTCGTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTCGCCGACGTTCTACGAC
ACGTCGTGCCCCAGGGCCCTGGCCACCATCAAGAGCGGCGTCATGGCCGCCGTGAGCAGC
GACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGACTGCTTCGTCCAAGGC
TGTGACGCGTCTGTTCTGCTGTCTGGCATGGAACAAAACGCTCTCCCGAACAACGGGTCA
CTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGAGGCCATCTGCGCCCAG
ACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACTCCGTCGTCGCCCTCGGA
GGGCCATCATGGACAGTCCCTCTGGGAAGAAGGGATTCCATAGATGCAAACGAGGCGGCG
GCAAACAGCGACCTCCCAGGCCCTACGTCTAGCCGTTCAGATCTTGAGCTGGCATTCAGC
AACAAGGGCCTCCTTACGGTCGACATGGTGGCCCTCTCCGGCGCGCACACCATCGGCCAG
GCGCAGTGCGGGACTTCAAGGACAGGATCTACAATGAGACCAACATCGACACGACCTTCG
CCACATCTCTCCGGGCCAACTTGCCCCGGTCCGGNGGCGAACGGCAGCCTGGCGAACCTG
GACACGACGACGGCCAACACCTTCGACAACGCCTACTACACCAAC
>441E-25 Sept_11-2001/YW091042.SEQ trimmed vector-stripped
GCACCACTCCACCAGTAAAGAAGTGCAGGCAACTAGCTAGCTAACCATGGCCGCCTCTGC
CTCTTGCATTTCACTGGTGGTGCTCGTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTC
GCCGACGTTCTACGACACGTCGTGCCCCAGGGCCCTGGCCACCATCAAGAGCGGCGTCAT
GGCCGCCGTGAGCAGCGACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGA
CTGCTTCGTCCAAGGCTGTGACGCGTCTGTTCTGCTGTCTGGCATGGAACAAAACGCTCT
CCCGAACAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGA
GGCCATCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACTC
CGTCGTCGCCCTCGGAGGGCCATCATG
>441E-536 Oct_25-2001/RH102519.Seq trimmed vector-stripped
GCACCACCGCTCCAGTAAGAAGTGCAGGTAGCTAGTAAGCAGGCGTGGCTTTGCTCTTCA
GCTCTTGTAGCTAGCTAGCTAACCATGGCCGCCTCTGCGTCCTGCATTTCTCTGGTGGTG
CTCGTGGCTCTGGCCACGGCGGCGTCGGGGCAGCTGTCGCCGACGTTCTACGACACGTCG
TGCCCCAGGGCTTTGGCCACCATCAAGAGCGGCGTCATGGCTGCCGTGAGCAGCGACCCT
CGGATGGGTGCGTCACTGCTCCGGCTGCACTTCCACGACTGCTTCGTCCAAGGCTGCGAC
GCGTCTGTTCTGCTGTCTGGCATGGAACAAAACGCTATCCCGAACGCAGGGTCGCTGAGG
GGCTTCGGCGTCATCGACAGCATCAAGACGCAGATCGAGGCCATCTGTAATCAGACCGTC
TCTTGCGCTGACATCCTCACCGTCGCCGCCCGCGACTCCGTCGTCGCCCTCGGGGGGCCC
GTCATGGACAGTCCCTTTTGGGGAGAAGAGATTCCATAGATGCAAACGAGGCAGAGGCAA
ACAGCGACCTTCCAGGCTTTAATTCTAGCCGCTCAGAGCTCGAGGCAGCATTCCTCAGGA
AGGCGGACTCAATACGGTCGANATGGTGGGCCCTCTCGGCGG
>441E-2504 08jan02wei5/441E2504.SEQ trimmed vector-stripped
GTCCACCAGTAAAGAAGTGCAGGCAACTAGCTAGCTAACCATGGCCGCCTCTGCCTCTTG
CATTTCACTGGTGGTGCTCGTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTCGCCGAC
GTTCTACGACACGTCGTGCCCCAGGGCCCTGGCCACCATCAAGAGCGGCGTCATGGCCGC
CGNGAGCAGCGACCCTCGGATGGGCGCGTCGCTGCTCCGGNTGCACTTCCACGACTGCTT
CGTCCAAGGCTGTGANNCGTCTGTTCTGNTGTCTGGCATGGAACAAAACGCTCTCCCGAA
CAACGGGTCACTGCGGGGNTTCNGCGTCCATCGACAGCATNCAANACACAGATCGAGGCC
ATCTGCGNCCAGACCGTCTCCTGCGCCGACATCCTCACCGNCNNTGCCCGNGACTCCGTC
CNTCNTCCCTCGNAAGGATCTATACATGNACAGTCCCCTCTGGGNAAAAAACGCANNTTT
NCNCAANNATCCCAACCNATAGNCGCAAGANNANACAACNACACGACCNNCACCTNANNA
NCCCATNNNCANNCTAAGNCCGCTANACANCANNNANCTCANNCTCTNNCCAACTTACNT
CTANNANNNATAAGCTACCCTTCATNTNTAACTNAGACACTGAACNNNNGGAGNTAGNGA
CCAACNTCTCTCTCAGCACNNTACACANNNATNACTATCCANTATCGCCTCNATCTNCCA
TCNTCACCTACAATNGAAGCCNCTNAANCACNCCCTNCTTCTTAANAGNGNTACTCTACT
GCGCTNTCTCTACNTNANNCTCACAGCNTGCACACCTNCCTTNCCCACCTCACTNNGAGT
ANAATNCNATACGTNAANNTCTNTCCTNTCTCCGCGACTCNACCAAAACANNNCNATNCT
CTTTTCTTNTACNCAGCTTATNCTCCCATCTTANCTTTNTCNACCCTCAACCTCCCTCNA
TCCANACNCCAACNNAANNGGNACNCTCANCTAANACNTAAAGTCCAANAAAACACACAT
CTNNTNACNCTACCCATTCCCCCCCCCTCCCCACNCCCCCNNANTTCNCTCACNCNTTAC
ACCACNCNNTTNCNCCNACTCAANTCCANCNCNTCATCCTCTATCCTANACTCANAAGCC
TGCCACACCTTNTAACCCNTCCCTACTTTATNCACTAAACTCATNCNNCTACAATATGCN
GNTNCACTCNCCNCCNATATACTNTACCTAAGCATTCTCCTCACACACA
>441E-471 Nov_1601_20-2000/Nov1601/RH111624.Seq trimmed vector-stripped [poly-A tail removed]
GCAGCGACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGACTGCTTCGTCC
AAGGCTGTGACGCGTCTGTTCTGCTGTCTGGCATGGAACAAAACGCTCTCCCGAACAACG
GGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGAGGCCATCTGCG
CCCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACTCCGTCGTCGCCC
TCGGAGGGCCATCATGGACAGTCCCTCTGGGAAGAAGGGATTCCATAGATGCAAACGAGG
CGGCGGCAAACAGCGACCTCCCAGGCCCTACGTCTAGCCGTTCAGATCTTGAGCTGGCAT
TCAGCAACAAGGGCCTCCTTACGGTCGACATGGTGGCCCTCTCCGGCGCGCACACCATCG
GCCAGGCGCAGTGCGGGACCTTCAAGGACAGGATCTACAATGAGACCAACATCGACACGA
CCTTCGCCACATCTCTCCGGGCCAACTGCCCCCGGTCCGGCGGCGACGGCAGCCTGGCGA
ACCTGGACACGACGACGGGCAACACCTTCGACAACGCCTACTACACCAACCTCATGTCAC
AGAAAGGGCTNCTGCACTCCGANCAAGTGCTGTTCAACAACGACACCACCGACAACACGG
TNCGGGAANTTTGCGTTCNAANCCGGNCGCANTTNAACAAGCGGCCNTTCACGAACGGGC
CATTGGATCAANAATGGGGGAAANATTCGCGGCCCCAAAAAAAAGGGAACCCCANGGGGC
CANAAATCANGGGNTCAACCTTTGGTTCCANGGGGNGGNAACTTCCCTGGANTTTTACGG
GAACNAAACCCCCAACCCTACNTAATTCNGGGTTGGGGCCTTCCCC
>441E-2320 wei7feb26/441E2320.SEQ trimmed vector-stripped
GGCGCGTCGCTGCTCCGGCTGCACTTCCACGACTGCTTCGTCCAAGGCTGTGACGCGTCT
GTTCTGCTGTCTGGCATGGAACAAAACGCTCTCCCGAACAACGGGTCACTGCGGGGCTTC
GGCGTCATCGACAGCATCAAGACACAGATCGAGGCCATCTGCGCCCAGACCGTCTCCTGC
GCCGACATCCTCACCGTCGCTGCCCGTGACTCCGTCGTCGCCCTCGGAGGGCCATCATGG
ACAGTCCCTCTGGGAAGAAGGGATTCCATAGATGCAAACGAGGCGGCGGCAAACAGCGAC
CTCCCAGGCCCTACGTCTAGCCGTTCAGATCTTGAGCTGGCATTCAGCAACAAGGGCCTC
CTTACGGTCGACATGGTGGCCCTCTCCGGCGCGNACACCATCGGCCAGGCGCAGTGCGGG
ACCTTCAAGGACAGGATCTACAATGAGACCAACATCGACACGACCTTCGCCACATCTCTC
CGGGCCAACTGCCCCCGGTCCGGCGGCGACGGCAGCCTGGCGAACTGGACACGACGACGG
CCAACACCTTCGACAACGCCTACTACACCAACCTCATGTCACAGAAGGGGGCTCCTGCAC
TCGGACCAGGTGCTGNTCCACAACGACACCACCGACAACACGGTCCGGAACTTTGNCGTC
CAACCCCGGCGCATTCNACAANCGCCTTTTCACGAACGGCCCAT
>441E-877 Dec21wei3/Dec21wei3/441E877.SEQ trimmed vector-stripped
GCTCCACCAGTAAAGAAGTGCAGGCAACTAGCTAGCTAACCATGGCCGCCTCTGCCTCTT
GCATTTCACTGGTGGTGCTCGTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTCGCCGA
CGTTCTACGACACGTCGTGCCCCAGGGCCCTGGCCACCATCAAGAGCGGCGTCATGGCCG
CCGTGAGCAGCGACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGACTGCT
TCGTCCAAGGCTGTGACGCGTCTGTTCTGCTGTCTGGCATGGAACAAAACGCTCTCCCGA
ACAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGAGGCCA
TCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACTCCGTCG
TCGCCCTCGGAGGGCCATCATGGACAGTCCCTCTGGGAAGAAGGGATTCCATAGATGCAA
ACGAGGCGGCGGCAAACAGCGACCTCCCAGGCCCTACGTCTAGCCGTTCAGATCTTGAGC
TGGCATTCAGCAACAAGGGCCTCCTTACGGTCGACATGGTGGCCTCTCCGGNGCGCACAC
CATCGGNCAGGCGCAGTGCGGGACCTTCAAGGACAGGATCTACAATGAGACCAACATCGA
CACGACCTTCGCCACATCTCTTCCGGGCCAAACTGCCCCCGGTCCCGGCGGNNGACGGNC
AANCCCNGNGCGNAACCTTGGGAAACCNAANGACGGCCCCAACAACCCTTC
>441E-532 Oct_17-2001/RH101614.SEQ trimmed vector-stripped
GCCACCACTCCACCAGTAAAGAAGTGCAGGCAACTANNTAGCTAACCATGGCCGCCTCTG
CCTCTTGCATTTCACTGGTGGTGCTCGNGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGT
CGCCGACGTTCTACGACACGTCGTGCCCCAGGGCCCTGGCCACCATCAAGAGCGGCGTCA
TGGCCGCCGTGAGCAGCGACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACG
ACTGCTTCGTCCAAGGCTGTGACGCGTCTGTTCTGCTGTCTGGCATGGAACAAAACGCTC
TCCCGAACAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCG
AGGCCATCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACT
CCGTCGTCGCCCTCGGAGGGCCATCATGGACAGTCCCTCTGGGAAGAAGGGATTCCATAG
ATGCAAACGAGGCGGCGGCAAACAGCGACCTCCCAGGCCCTACGTCTAGCCGTTCAGATC
TTGAGCTGGCATTCAGCAACAAGGGCCTCCTTACGGTCGACATGGTGGGCCCTCTCCGGC
GCGCACACCATCGGNCAGGCGCAGTGCGGGGACCTTCAAGGACAGGATTTTACAATGANA
CCAACATCGAACACGACCTTCGCCACATTCTCTTCCGGGGCCAANTGCCCCCGGTCCGGN
GGGNGACGGGCAGCCTGGCGAAACCTGGGACACGAAAGACNGNCCAACACCTTCGANAAA
GGCNTACTTACAACAAACCTTCATGGTNNCAGAAAAGGGCTTCCTGGCACTCGGAC
>441E-1102 Oct_25-2001/RH102501.Seq trimmed vector-stripped
GCCGCTCCAGTAAGAAGTGCAGGTAGCTAGTAAGCAGGCGTGGCTTTGCTCTTCAGCTCT
TGTAGCTAGCTAGCTAACCATGGCCGCCTCTGCGTCCTGCATTTCTCTGGTGGTGCTCGT
GGCTCTGGCCACGGCGGCGTCGGGGCAGCTGTCGCCGACGTTCTACGACACGTCGTGCCC
CAGGGCTTTGGCCACCATCAAGAGCGGCGTCATGGCTGCCGTGAGCAGCGACCCTCGGAT
GGGTGCGTCACTGCTCCGGCTGCACTTCCACGACTGCTTCGTCCAAGGCTGCGACGCGTC
TGTTCTGCTGTCTGGCATGGAACAAAACGCTATCCCGAACGCAGGGTCGCTGAGGGGCTT
CGGCGTCATCGACAGCATCAAGACGCAGATCGAGGCCATCTGTAATCAGACCGTCTCTTG
CGCTGACATCCTCACCGTCGCCGCCCGCGACTCCGTCGTCGCCCTCGGGGGGCCGTCATG
GACAGTCCCTTTGGGGAGAAGAGATTCCATAGATGCAAACGAGGCAGAGGCAAACAGCGA
CCTTCCAGGCTTTAATTCTAACCGCTCANAGCTCGAGGCAGCATTCCTCAGGAAAGGCGG
ACTCAATACGGTCGACATGGTGGGCCTCTCGGGCGCGCACACATCGGCCAGGCGCAATGC
TCGACTTCCGGGCTCGGATCTACGGCGGTGGACACCAACATCAATG
>Cyanophora NC_001675 Cyanophora paradoxa cyanelle
ATGGCAAGACAGAAATTTGACGGAAATAAACCACATGTAAACATTGGTACTATTGGTCACGTTGACCATG
GAAAAACTACCTTAACTGCTGCAATTACAACTGCTCTAGCATCCCAAGGTAAAGGAAAAGCTCGTAAATA
TGATGAAATTGATGCTGCTCCAGAAGAAAAAGCACGTGGTATTACTATTAATACTGCACACGTAGAATAT
GAGACTGAAAAACGTCATTATGCACACGTAGATTGCCCAGGACACGCAGATTATGTGAAAAACATGATTA
CAGGTGCAGCTCAAATGGACGGAGCTATTTTAGTTGTTTCTGCAGCTGATGGTCCAATGCCTCAAACTCG
TGAACATATTCTGTTAGCAAAACAAGTTGGTGTTCCGAACATGGTTGTTTTCTTAAATAAAGAAGACCAA
ATTGATGACGCTGATTTATTAGAATTAGTAGAATTAGAAGTTCGTGAATTATTAAGCAAATATGATTTCC
CAGGTGATCAAATTCCGTTCGTTAGTGGTTCTGCGTTATTAGCTTTAGAAAGTCTAAGTTCTAATCCAAA
ACTTATGCGTGGCGAAGATAAATGGGTAGATAAAATTCTTGCTTTAATGGATGCAGTTGATGAATATATT
CCTACTCCAGAACGTCCAATCGATAAATCTTTCTTAATGGCAATTGAAGATGTTTTCTCTATTACCGGTC
GTGGTACAGTAGCTACTGGTAGAATTGAAAGAGGTGCTATTAAGGTTGGTGAAACAGTTGAATTAGTAGG
TTTAAAAGATACTAAATCAACAACAGTTACTGGTTTAGAAATGTTCCAAAAAACATTAGAAGAAGGGATG
GCTGGTGATAACATCGGTATTCTTCTTCGTGGTGTTCAAAAAACTGATATTGAGCGTGGTATGGTTTTAG
CAAAACCAGGTTCTATTACTCCACATACTCAATTTGAATCTGAAGTTTATGTATTAACAAAAGATGAAGG
TGGTCGTCATACTCCATTCTTCTCTGGATATCGTCCACAATTTTATGTACGTACTACTGATGTTACTGGT
AGCATTGATGCGTTTACTGCAGATGATGGTAGTAATGCAGAAATGGTTATGCCAGGAGATCGTATTAAAA
TGACAGTAAGTTTAGTACATCCAATTGCGATTGAACAAGGTATGCGTTTCGCGATTCGTGAAGGTGGTCG
TACAATTGGTGCAGGTGTAGTTTCTAAGATTTTAAAATAA
>Streptococcus NC_004116:757604..758800 Streptococcus agalactiae 2603V/R
ATGGCAAAAGAAAAATACGATCGTAGTAAACCACACGTTAACATTGGTACAATCGGACACGTTGACCACG
GTAAAACTACTTTAACAGCAGCTATCACAACTGTATTGGCACGTCGCTTGCCTACTTCAGTTAACCAACC
AAAAGATTACGCTTCTATCGATGCTGCTCCAGAAGAGCGCGAACGCGGAATCACAATCAACACTGCACAC
GTTGAGTACGAAACTGAAAAACGTCACTATGCCCACATCGACGCTCCAGGACACGCGGACTACGTTAAAA
ACATGATCACTGGTGCTGCTCAAATGGACGGAGCTATCCTTGTAGTTGCTTCAACTGATGGACCAATGCC
ACAAACTCGTGAGCACATCCTTCTTTCACGTCAAGTTGGTGTTAAACACCTTATCGTATTCATGAACAAA
GTTGACCTTGTTGATGATGAAGAATTGCTTGAATTGGTTGAAATGGAAATTCGTGACCTTCTTTCAGAAT
ACGACTTCCCAGGTGATGACCTTCCAGTTATCCAAGGTTCAGCTCTTAAAGCACTTGAAGGCGACGAAAA
ATACGAAGACATCATCATGGAATTGATGAGCACTGTTGATGAGTACATTCCAGAACCAGAACGTGATACT
GACAAACCTTTACTTCTTCCAGTTGAAGATGTATTCTCAATCACTGGACGTGGTACAGTTGCTTCAGGAC
GTATCGACCGTGGTACTGTTCGTGTCAACGACGAAGTTGAAATCGTTGGTATTAAAGAAGATATCCAAAA
AGCAGTTGTTACTGGTGTTGAAATGTTCCGTAAACAACTTGACGAAGGTCTTGCAGGGGACAACGTTGGT
GTTCTTCTTCGTGGTGTTCAACGTGATGAAATCGAACGTGGTCAAGTTCTTGCTAAACCAGGTTCAATCA
ACCCACACACTAGATTTAAAGGTGAAGTTTACATCCTTTCTAAAGAAGAAGGTGGACGTCATACTCCATT
CTTCAACAACTACCGTCCACAATTCTACTTCCGTACAACTGACGTAACAGGTTCAATCGAACTTCCAGCA
GGAACAGAAATGGTTATGCCTGGTGATAACGTTACTATCGAAGTTGAATTGATTCACCCAATCGCCGTAG
AACAAGGTACTACTTTCTCAATCCGTGAAGGTGGACGTACTGTTGGTTCAGGTATCGTTTCAGAAATCGA
AGCTTAA
>Shigella NC_004741 Shigella flexneri 2a str. 2457T
ATGTCTAAAGAAAAGTTTGAACGTACAAAACCGCACGTTAACGTCGGTACTATCGGCCACGTTGACCATG
GTAAAACAACGCTGACCGCTGCAATCACTACCGTACTGGCTAAAACCTACGGCGGTGCTGCTCGCGCATT
CGACCAGATCGATAACGCGCCGGAAGAAAAAGCTCGTGGTATCACCATCAACACTTCTCACGTTGAATAC
GACACCCCGACCCGTCACTACGCACACGTAGACTGCCCGGGGCACGCCGACTATGTTAAAAACATGATCA
CCGGTGCTGCTCAGATGGACGGCGCGATCCTGGTAGTTGCTGCGACTGACGGCCCGATGCCGCAGACTCG
TGAGCACATCCTGCTGGGTCGTCAGGTAGGCGTTCCGTACATCATCGTGTTCCTGAACAAATGCGACATG
GTTGATGACGAAGAGCTGCTGGAACTGGTTGAAATGGAAGTTCGTGAACTTCTGTCTCAGTACGACTTCC
CGGGCGACGACACTCCGATCGTTCGTGGTTCTGCTCTGAAAGCGCTGGAAGGCGACGCAGAGTGGGAAGC
GAAAATCCTGGAACTGGCTGGCTTCCTGGATTCTTACATTCCGGAACCAGAGCGTGCGATTGACAAGCCG
TTCCTGCTGCCGATCGAAGACGTATTCTCCATCTCCGGTCGTGGTACCGTTGTTACCGGTCGTGTAGAAC
GCGGTATCATCAAAGTTGGTGAAGAAGTTGAAATCGTTGGTATCAAAGAGACTCAGAAGTCTACCTGTAC
TGGCGTTGAAATGTTCCGCAAACTGCTGGACGAAGGGCGTGCTGGTGAGAACGTAGGTGTTCTGCTGCGT
GGTATCAAACGTGAAGAAATCGAACGTGGTCAGGTACTGGCTAAGCCGGGCACCATCAAGCCGCACACCA
AGTTCGAATCTGAAGTGTACATTCTGTCCAAAGATGAAGGCGGTCGTCATACTCCGTTCTTCAAAGGCTA
CCGTCCGCAGTTCTACTTCCGTACTACTGACGTGACTGGTACCATCGAACTGCCGGAAGGCGTAGAGATG
GTAATGCCGGGCGACAACATCAAAATGGTTGTTACCCTGATCCACCCGATCGCGATGGACGACGGTCTGC
GTTTCGCAATCCGTGAAGGCGGCCGTACCGTTGGCGCGGGCGTTGTAGCAAAAGTTCTGAGCTAA
>Pseudomonas NC_008027.1 Pseudomonas entomophila L48
GTGGCTAAAGAAAAATTTGATCGTTCCCTTCCCCACGTTAACGTCGGCACTATCGGCCACGTTGACCACG
GTAAGACCACTCTGACCGCAGCTCTGACTCGCGTCTGCTCCGAAGTTTTCGGTTCGGCCGTCGTTGAGTT
CGACAAGATCGACTCGGCTCCAGAAGAAAAAGCGCGCGGTATCACCATCAACACCGCTCACGTCGAGTAC
AACTCGAACATTCGTCACTACGCTCACGTTGACTGCCCAGGTCACGCTGACTACGTGAAGAACATGATCA
CCGGTGCTGCCCAGATGGACGGCGCGATCCTGGTTTGCTCGGCCGCCGATGGTCCGATGCCACAAACCCG
TGAGCACATCCTGCTGTCCCGTCAGGTTGGCGTTCCGTACATCGTGGTCTTCCTGAACAAGGCTGACCTG
GTAGATGACGCTGAGCTGCTGGAACTGGTCGAGATGGAAGTTCGCGACCTGCTGTCCACCTACGACTTCC
CAGGCGACGACACCCCGATCATCATCGGTTCGGCTCGTATGGCGCTGGAAGGCAAAGACGACAACGAAAT
GGGCACTACCGCTGTCAAGAAGCTGGTAGAAACTCTGGATGCCTACATCCCTGAGCCAGTTCGTGCCATC
GACCAGCCGTTCCTGATGCCGATCGAAGACGTATTCTCGATCTCGGGTCGTGGTACCGTTGTTACCGGCC
GTATCGAGCGTGGTATCGTCCGCGTTCAAGACCCGCTGGAAATCGTTGGTCTGCGTGACACCACCACCAC
CACCTGCACCGGCGTTGAGATGTTCCGCAAGCTGCTGGACGAAGGTCGTGCTGGCGAGAACTGCGGCGTC
CTGCTGCGTGGTACCAAGCGTGACGACGTTGAGCGTGGCCAGGTTCTGGTCAAGCCAGGTTCGGTCAAGC
CGCACACCAAGTTCACCGCAGAAGTCTACGTCCTGTCGAAGGAAGAAGGCGGTCGTCACACTCCGTTCTT
CAAAGGCTACCGTCCTCAGTTCTACTTCCGTACCACTGACGTGACCGGTAACTGCGAGCTGCCGGAAGGC
GTTGAAATGGTAATGCCAGGTGACAACATTCAGATGACTGTCACCCTGATCAAGACCATCGCAATGGAAG
ACGGTCTGCGCTTCGCCATCCGTGAAGGCGGTCGTACCGTCGGCGCCGGCGTCGTAGCCAAAATCATCGA
GTAA
>Myxococcus NC_008095.1 Myxococcus xanthus DK 1622
ATGGCCAAGGAGAAGTTCGAGCGTAACAAGCCCCACGTGAACATCGGCACGATCGGACACGTGGACCACG
GCAAGACGTCGCTGACGGCCGCCATCACCAAGGTGCTGGCGAAGACGGGCGGCGCCACGTTCCTGGCGTA
CGACCTGATTGACAAGGCGCCGGAGGAGCGTGAGCGCGGTATCACGATTTCCACCTCGCACGTGGAGTAC
CAGACGTCGAACCGGCACTACGCCCACGTCGACTGTCCGGGCCACGCCGACTACGTGAAGAACATGATCA
CGGGCGCGGCGCAGATGGACGGCGCCATCCTGGTGGTGTCGGCGGCGGACGGCCCGATGCCGCAGACGCG
TGAGCACATCCTGCTGGCGCGCCAGGTCGGCGTTCCGTACATCGTGGTCTTCCTGAACAAGGTGGACATG
CTGGACGACCCCGAGCTGCGCGAGCTCGTGGAGATGGAAGTCCGCGACCTGCTGAAGAAGTACGAGTTCC
CTGGCGATGACATCCCCATCATCCCGGGCTCGGCGCTGAAGGCGCTGGAGGGTGACACCAGCGACATCGG
CGAGCCGGCCATCCTGAAGCTGATGGAGGCGGTGGACAGCTACATCCCGACGCCGCAGCGCGCGACGGAC
AAGCCCTTCCTGATGCCGGTGGAGGACGTGTTCTCCATCTCCGGCCGCGGCACGGTGGCCACGGGCCGCG
TCGAGCGCGGTATCATCAAGGTCGGCGAGGAAGTGGAAGTCGTTGGTCTGCGCCCGACGCAGAAGACGGT
CGTCACGGGCGTGGAGATGTTCCGCAAGCTGCTGGACCAGGGCATGGCGGGCGACAACATCGGCGCGCTG
GTGCGCGGCCTGAAGCGCGAGGACATGGAGCGCGGCCAGGTGCTGGCCAAGCCGGGCAGCATCACCCCGC
ACACCAAGTTCAAGGCGCAGATCTACGTGCTGTCGAAGGAAGAGGGCGGTCGTCACACCCCGTTCTTCAA
GGGCTACCGCCCGCAGTTCTACTTCCGCACCACGGACGTGACGGGCTCGGTGAAGCTGCCGGAGAACGTC
GAAATGGTGATGCCGGGCGACAACATCGCCATCGAGGTGGAGCTCATCACCCCCGTGGCCATGGAGAAGG
AGCTGCGCTTCGCTGTTCGCGAGGGTGGCCGCACCGTGGGCGCCGGCGTCGTGGCGGAAATCATCGAGTA
A
>Chlamydia NC_010280 Chlamydia trachomatis L2b/UCH-1/proctitis
ATGTCAAAAGAAACTTTTCAACGTAATAAGCCTCATATCAACATAGGGACCATTGGCCACGTTGACCATG
GTAAGACTACGTTGACAGCTGCTATTACGCGTACGTTGTCTGGAGATGGGTTGGCTGATTTTCGTGATTA
TAGCTCTATTGACAACACTCCTGAAGAAAAAGCTCGCGGTATTACAATTAACGCTTCCCACGTTGAGTAC
GAAACAGCTAATCGTCACTACGCTCACGTGGACTGCCCTGGTCACGCTGACTATGTTAAAAACATGATCA
CCGGTGCGGCTCAAATGGACGGGGCTATTCTAGTAGTTTCTGCAACAGACGGAGCTATGCCTCAAACTAA
AGAGCATATTCTTTTGGCAAGACAAGTTGGGGTTCCTTACATCGTTGTTTTTCTCAATAAAATTGACATG
ATTTCCGAAGAAGACGCTGAATTGGTCGACTTGGTTGAGATGGAGTTGGCTGAGCTTCTTGAAGAGAAAG
GATACAAAGGGTGTCCAATCATCAGAGGTTCTGCTCTGAAAGCTTTGGAAGGGGATGCTGCATACATAGA
GAAAGTTCGAGAGCTAATGCAAGCCGTCGATGATAATATCCCTACTCCAGAAAGAGAAATTGACAAGCCT
TTCTTAATGCCCATTGAGGACGTGTTCTCTATCTCCGGACGAGGAACTGTAGTAACTGGACGTATTGAGC
GTGGAATTGTTAAAGTTTCCGATAAAGTTCAGTTGGTCGGTCTTAGAGATACTAAAGAAACGATTGTTAC
TGGGGTTGAAATGTTCAGAAAAGAACTCCCAGAAGGTCGTGCAGGAGAGAATGTTGGATTGCTCCTCAGA
GGTATTGGTAAGAACGATGTGGAAAGAGGAATGGTTGTTTGCTTGCCAAACAGTGTTAAACCTCATACAC
GGTTTAAGTGTGCTGTTTACGTTCTGCAAAAAGAAGAAGGTGGACGACATAAGCCTTTCTTCACAGGATA
TAGACCTCAATTCTTCTTCCGTACAACAGACGTTACAGGTGTGGTAACTCTGCCTGAGGGAGTTGAGATG
GTCATGCCTGGGGATAACGTTGAGTTTGAAGTGCAGTTGATTAGCCCTGTGGCTTTAGAAGAAGGTATGA
GATTTGCGATTCGTGAAGGTGGTCGTACAATCGGTGCTGGAACTATTTCTAAGATCATTGCATAA
>Staphylococcus NC_013893 Staphylococcus lugdunensis HKU09-01
ATGGCAAAAGAAAAATTCGATCGCTCAAAAGAACATGCCAATATTGGTACTATCGGTCACGTTGACCATG
GTAAAACTACTTTAACAGCTGCAATTGCAACTGTATTAGCAAAAAATGGTGACACTGTAGCACAATCATA
CGACATGATTGACAACGCTCCAGAAGAAAAAGAACGTGGTATTACAATCAATACTGCACACATCGAATAT
CAAACTGATAAACGTCACTATGCGCACGTTGACTGCCCAGGACACGCTGACTATGTTAAAAACATGATCA
CTGGTGCTGCTCAAATGGACGGCGGTATCTTAGTAGTTTCTGCTGCAGATGGTCCAATGCCACAAACTCG
TGAACACATTCTTTTATCACGTAACGTTGGTGTGCCAGCATTAGTAGTATTCTTAAACAAAGTTGACATG
GTTGACGATGAAGAATTATTAGAATTAGTAGAAATGGAAGTTCGTGATTTATTAACTGAATATGACTTCC
CAGGTGACGATGTGCCTGTAATCGCTGGTTCAGCATTAAAAGCTTTAGAAGGCGACGAAAAATACGAAGC
TAAAATCTTAGAATTAATGGATGCAGTTGATAACTACATTCCAACTCCAGAACGTGACTCTGACAAACCA
TTCATGATGCCAGTTGAGGACGTATTCTCAATCACTGGTCGTGGTACTGTTGCTACAGGCCGTGTTGAAC
GTGGTCAAATCAAAGTCGGTGAAGAAGTTGAAATTATTGGTATCCACGATACTACTAAAACAACGGTTAC
TGGTGTAGAAATGTTCCGTAAATTATTAGACTATGCTGAAGCTGGTGACAACATCGGTGCGTTATTACGT
GGTGTTGCTCGTGAAGATGTACAACGTGGACAAGTATTAGCTGCTCCAGGTTCAATTACACCTCACACTA
AATTTAAAGCTGACGTATATGTTTTATCTAAAGATGAAGGTGGACGTCATACACCATTCTTCTCAAACTA
CCGTCCACAATTCTATTTCCGTACTACAGACGTAACTGGTGTTGTTAACTTACCAGAAGGTACAGAAATG
GTTATGCCTGGTGACAACGTTGAAATGACAGTTGAATTAATCGCTCCAATCGCTATCGAAGACGGAACTC
GTTTCTCAATTCGTGAAGGTGGACGTACTGTAGGATCAGGCGTTGTAACTGAAATTATGGAATAA
>Mycoplasma NC_014014 Mycoplasma crocodyli MP145
ATGGCAAAAATAGATTTTGACCGTAGCAAAGAACACGTTAACGTTGGAACAATCGGACACGTTGACCATG
GAAAAACAACTTTAACAGCTGCAATTGCTACAGTTTTATCAAAAAAAGGATTATCAGAAGCTCGTGATTA
TGCTTCAATCGATAATGCACCAGAAGAAAAAGCACGTGGGATAACAATTAATACTTCACACGTTGAATAT
CAAACAGAAAAACGTCACTACGCACACGTTGACTGTCCTGGTCACGCTGACTACGTTAAAAACATGATTA
CCGGAGCAGCTCAAATGGATGGAGCAATCTTAGTTGTTGCTGCAACAGATGGACCAATGCCTCAAACAAA
AGAACACATTCTTTTATCAAGACAAGTTGGAGTTCCTCGTATTGTTGTTTTCTTAAACAAATGCGACATG
CTACAAGGTAAAGACGGTGAAGAAATGATCGACCTTGTTGAAATGGAAATACGTGGATTATTATCAGAAT
ACGGATTTGATGGAGATAATGCACCAGTTGTTCGTGGATCAGCATTACAAGCTTTACAAGGAAATGCAGA
ATACGAAGACAAAATTATGGAATTAATGTCTGCGGTTGATGAATACATTTTAACACCTCAAAAAGACTTA
GACAAACCATTCTTAATGGCCGTTGAAGACGTTTTCACAATTACAGGACGTGGAACTGTTGCTACAGGAC
GTGTAGAACGTGGAACATTAAAATTAAATGATGAAGTTGAAATTGTTGGGTTACACGCAACTAAAAAAAC
AGTTGTTACAGGAATTGAAATGTTCCGTAAAAACTTAAAAGAAGCTTTAGCTGGGGATAATGCAGGATTA
TTACTACGTGGAATTAACCGTGAAGATGTAGAACGTGGACAAGTATTAGCTAAACCAGGTTCAATTATTC
CTCACACAGAATTCGAAGCTGCAATTTATGTACTTAAAAAAGAAGAAGGTGGACGTCATACACCATTCTT
AAAGAACTATAAACCTCAATTCTACTTCCGTACAACAGACGTTACTGGTGGAGTTGAATTCGAAGCTGGA
CGTGAAATGGTTATGCCAGGAGAAAATGTTAACTTAAAAGTTAAACTTATTGCTCCTATCGCTGTTGAAG
CAGGAACAAAATTCTCTATCCGTGAAGGTGGACGTACAGTTGGTGCTGGTTCAGTAACAAAAATTATTAA
ATAA
......@@ -15,3 +15,4 @@ bash-4.4$
bash-4.4$ ./biopython4.py
bash-4.4$
\ No newline at end of file
......@@ -12,7 +12,7 @@ Entrez.email = "binfo200@cs.usask.ca"
# and the accession number to look for is DQ091202. It happens to be
# the record for the Elephas maximus HBB/D gene.
socketObj = Entrez.efetch( db="nucleotide", rettype="fasta",
id="DQ091202" )
id="M62653" )
# the above creates a socket object that works like a typical file object.
# Hence we can use SeqIO to read from it.
......
dive depth latitude longitude date comment
Tiburon 596 1190 36.60200 -122.37467 19-Jul-03 holotype
JSL II 1411 518 39.94000 -70.23833 16-Sep-86 paratype
JSL II 930 686 40.08383 -69.05017 18-Aug-84 Youngbluth (1989)
Ventana 1575 767 36.70400 -122.04200 11-Mar-99
Ventana 1777 934 36.71000 -122.04500 16-Jun-00
Ventana 2243 1001 36.70800 -122.06400 9-Sep-02
Tiburon 515 1156 36.70000 -122.03300 24-Nov-02
Tiburon 531 1144 24.31700 -109.20300 13-Mar-03
Tiburon 547 1126 24.23400 -109.66700 31-Mar-03
JSL II 3457 862 40.29617 -68.11133 26-Sep-03 Francesc Pages (pers.comm)
File mode changed from 100644 to 100755
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment