Commit c8d5b177 authored by Lingling Jin (lij313)'s avatar Lingling Jin (lij313)
Browse files

dot plots examples

parent 10c7596b
>gi|172047303|sp|P00435.3|GPX1_BOVIN RecName: Full=Glutathione peroxidase 1; Short=GPx-1; Short=GSHPx-1; AltName: Full=Cellular glutathione peroxidase
MCAAQRSAAALAAAAPRTVYAFSARPLAGGEPFNLSSLRGKVLLIENVASLUGTTVRDYTQMNDLQRRLG
PRGLVVLGFPCNQFGHQENAKNEEILNCLKYVRPGGGFEPNFMLFEKCEVNGEKAHPLFAFLREVLPTPS
DDATALMTDPKFITWSPVCRNDVSWNFEKFLVGPDGVPVRRYSRRFLTIDIEPDIETLLSQGASA
>441E-414
GGCGGACCCCACTTCGACGTGGCTCTGGGCCGACGTGACGGGCTGGCCCCAGCGTTGGAG
GATCTCGTCTCCACCCTACCGGCGCCCTCCTTCACCGTGCCGGAACTCCTCAAGTCTTTC
GGCGACCGAAACCTCGACAAGGCGGACCTGGTGTCCCTCTCTGGCGCGCACTCCTTCGGC
ATCGCCCACTGCTCCTCCTTCTCCGACCGCTTCACGCCGGTCGACGACACCGACCTAGTC
ATCGACCCCAATTTCGCGGCCAAGTTGAGGGCCAAGTGTGCTAAGGACATGCCTGCGGGC
ACCGTCAACCAGACCCTCGATTTGCGTACGCCGGACGTGTTCGACAACAAGTACTACTTT
GATCTCATTGCCAAGCAGGGTCTGTTCAAGTCGGACCAGGGCCTCATCGTCCACCCCAAC
ACCACGCGCATGGCGACGCGGTTCTCGCTCAACCAGGGGGCATTCTTCGAGCAGTTCGCC
AAATCCATGGTGAAGATGAGCAACATGGACTTGCTCACCGGCAGCCAGGGCGAGATCCGG
TTCAACTGCGCCGTCCCCAACAGCCGTGTCAAGGGCATCGAGACCGCCAGCGACGAGGGC
CATGCCGCCGCCATGTAAGAGATTGGTTAGTCGCCGTGCTTGCTTGAAGCGTGTGAGTCG
TGTGTGCGCTACGATCGTGTCATGGTGCTAGTGGTTTTGCGTAATCGTGATGTTGNAATA
AAGTGAGTGAACAGACATTCATGCCCCAAGTATATG
>441E-590 Nov_16c/Nov16c/441E-590.SEQ trimmed vector-stripped
GCGTCGACGTTCTACGACACGTCGTGCCCCAGGGCTCTGGCCACCATCAAGAGCGGCGTG
GCGGCAGCCGTGAGCAGCGATCCCCGCATGGGCGCCTCCCTGCTCAGGCTGCACTTCCAC
GACTGCTTTGTCCAAGGCTGTGACGCGTCTGTTCTTCTGTCCGGCATGGAACAAAACGCG
GGTCCGAACGTGGGGTCGCTGAGGGGCTTCGGCGTCATCGACAACATCAAGACCCAGCTG
GAGAGTATATGCAAGCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCCGCCCGCGAC
TCCGTTGTCGCCCTTGGAGGGCCATCGTGGACTGTCCCGCTGGGGAGACGGGACTCCACC
ACCGCAAGTGCCTCGCTGGCGAACAGTGACCTCCCTGGCCCGAGCTCTAGCCGGTCACAG
CTCGAGGCCGCGTTCCTCAAGAAGAACCTTAACACGGTCGACATGGTCGCGCTCTCAGGC
GCGCACCACATCGGGAAGNCCAGTGCTCCAACTTTCGGACTCGGATCTACGGGGGTGACA
ACAACATCAAACACTGGCTTCCGACGTCTCTCAAGGNCAAACTGCCCCCCAGTCCCGGGG
GGCAAACAACCAAACCTTGGNCGNAACCNTGGGAACACNNANCGAACGCCCCCAAANGGC
GTTTTCNGAACAAAACGGCCCTTNACTTNCAACCCAAAACCCTTCCCTTGGTCAACAAAA
AAAAAANGGGGGNTTCCCCTTGGGNAACTTCGNGGAAANCCAAANGGNGGGGTTTCTTTT
AAAAACAAAC
>441E-1197
GCACCACTCCACCAGTAAAGAAGTGCAGGCAACTAGCTAGCTAACCATGGCCGCCTCTGC
CTCTTGCATTTCACTGGTGGTGCTCGTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTC
GCCGACGTTCTACGACACGTCGTGCCCCAGGGCCCTGGCCACCATCAAGAGCGGCGTCAT
GGCCGCCGTGAGCAGCGACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGA
CTGCTTCGTCCAAGGCTGTGACGCGTCTGTTCTGCTGTCTGGCATGGAACAAAACGCTCT
CCCGAACAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGA
GGCCATCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACTC
CGTCGTCGCCCTCGGAGGGCCATCATGGACAGTCCCTCTGGGAAGAAGGGATTCCATANA
TGNAAACGAGGNGGTGGCAAACAGCGACTCCCAGCCCTACGTCTAGCCGTTCAGATCTTG
AG
This diff is collapsed.
# Revision of standard EDNAMAT which accounts for AGCTU plus "N"
# We will treat N matching with any base as having a score of 0
# i.e. neither good nor bad. Note that N-N is given a score of
# 0 and U-T is considered a mismatch.
A C G N T U
A 5 -4 -4 0 -4 -4
C -4 5 -4 0 -4 -4
G -4 -4 5 0 -4 -4
N 0 0 0 0 0 0
T -4 -4 -4 0 5 -4
U -4 -4 -4 0 -4 5
>P00435.3 RecName: Full=Glutathione peroxidase 1; Short=GPx-1; Short=GSHPx-1; AltName: Full=Cellular glutathione peroxidase
MCAAQRSAAALAAAAPRTVYAFSARPLAGGEPFNLSSLRGKVLLIENVASLUGTTVRDYTQMNDLQRRLG
PRGLVVLGFPCNQFGHQENAKNEEILNCLKYVRPGGGFEPNFMLFEKCEVNGEKAHPLFAFLREVLPTPS
DDATALMTDPKFITWSPVCRNDVSWNFEKFLVGPDGVPVRRYSRRFLTIDIEPDIETLLSQGASA
\ No newline at end of file
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment