Commit a5f0f2f9 authored by Lingling Jin (lij313)'s avatar Lingling Jin (lij313)
Browse files

add 2022.01.17 files

parent 6c18dc34
Accession ID
P03375 ENV_HV1B1
P03377 ENV_HV1BR
P04581 ENV_HV1EL
P03378 ENV_HV1A2
Accession TaxID
P03375 11678
P03377 11686
P04581 11689
P03378 11685
This diff is collapsed.
Contig
247
60
209
77
153
242
171
ALG1
APOC4
ARID1B
ASCC3L1
BDNF
C7orf16
CA2
CD74
CDC2L2
CDS2
DAPK1
E2F1
ERCC1
GPATC3
HLA-A
HMGB3
HTR5A
ICA1
LRRC23
MMP21
NFATC2IP
OR1G1
PCDHGC4
PDE1A
PLG
RAB9A
RGS6
SUSD1
TMEM45B
ZBTB8OS
Gene
fumC
gdh
glnA
gnd
pilA
pyrD
serC
>441E-414 Nov_15b-2017/Nov15b/414T3.SEQ
Accession Length
P03375 856
P03377 861
P04581 853
P03378 855
########################################
# Program: needle
# Rundate: Thu Jul 04 17:04:41 2018
# Report_file: 414T3.needle
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: 441E-414
# 2: 441E-414
# Matrix: DNAMAT
# Gap_penalty: 10.0
# Extend_penalty: 0.5
#
# Length: 904
# Identity: 776/904 (85.8%)
# Similarity: 772/904 (85.4%)
# Gaps: 128/904 (14.2%)
# Score: 3860.0
#
#
#=======================================
441E-414 1 GTGGATTCCCCGCGGTGGCGGCGCTCTAGAACTAGTGGGATCCCCCGGGC 50
441E-414 1 0
441E-414 51 TGCAGGAATTCGGCACGAGGGCGGACCCCACTTCGACGTGGCTCTGGGCC 100
|||||||||||||||||||||||||||||||
441E-414 1 GGCGGACCCCACTTCGACGTGGCTCTGGGCC 31
441E-414 101 GACGTGACGGGCTGGCCCCAGCGTTGGAGGATCTCGTCTCCACCCTACCG 150
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 32 GACGTGACGGGCTGGCCCCAGCGTTGGAGGATCTCGTCTCCACCCTACCG 81
441E-414 151 GCGCCCTCCTTCACCGTGCCGGAACTCCTCAAGTCTTTCGGCGACCGAAA 200
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 82 GCGCCCTCCTTCACCGTGCCGGAACTCCTCAAGTCTTTCGGCGACCGAAA 131
441E-414 201 CCTCGACAAGGCGGACCTGGTGTCCCTCTCTGGCGCGCACTCCTTCGGCA 250
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 132 CCTCGACAAGGCGGACCTGGTGTCCCTCTCTGGCGCGCACTCCTTCGGCA 181
441E-414 251 TCGCCCACTGCTCCTCCTTCTCCGACCGCTTCACGCCGGTCGACGACACC 300
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 182 TCGCCCACTGCTCCTCCTTCTCCGACCGCTTCACGCCGGTCGACGACACC 231
441E-414 301 GACCTAGTCATCGACCCCAATTTCGCGGCCAAGTTGAGGGCCAAGTGTGC 350
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 232 GACCTAGTCATCGACCCCAATTTCGCGGCCAAGTTGAGGGCCAAGTGTGC 281
441E-414 351 TAAGGACATGCCTGCGGGCACCGTCAACCAGACCCTCGATTTGCGTACGC 400
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 282 TAAGGACATGCCTGCGGGCACCGTCAACCAGACCCTCGATTTGCGTACGC 331
441E-414 401 CGGACGTGTTCGACAACAAGTACTACTTTGATCTCATTGCCAAGCAGGGT 450
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 332 CGGACGTGTTCGACAACAAGTACTACTTTGATCTCATTGCCAAGCAGGGT 381
441E-414 451 CTGTTCAAGTCGGACCAGGGCCTCATCGTCCACCCCAACACCACGCGCAT 500
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 382 CTGTTCAAGTCGGACCAGGGCCTCATCGTCCACCCCAACACCACGCGCAT 431
441E-414 501 GGCGACGCGGTTCTCGCTCAACCAGGGGGCATTCTTCGAGCAGTTCGCCA 550
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 432 GGCGACGCGGTTCTCGCTCAACCAGGGGGCATTCTTCGAGCAGTTCGCCA 481
441E-414 551 AATCCATGGTGAAGATGAGCAACATGGACTTGCTCACCGGCAGCCAGGGC 600
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 482 AATCCATGGTGAAGATGAGCAACATGGACTTGCTCACCGGCAGCCAGGGC 531
441E-414 601 GAGATCCGGTTCAACTGCGCCGTCCCCAACAGCCGTGTCAAGGGCATCGA 650
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 532 GAGATCCGGTTCAACTGCGCCGTCCCCAACAGCCGTGTCAAGGGCATCGA 581
441E-414 651 GACCGCCAGCGACGAGGGCCATGCCGCCGCCATGTAAGAGATTGGTTAGT 700
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 582 GACCGCCAGCGACGAGGGCCATGCCGCCGCCATGTAAGAGATTGGTTAGT 631
441E-414 701 CGCCGTGCTTGCTTGAAGCGTGTGAGTCGTGTGTGCGCTACGATCGTGTC 750
||||||||||||||||||||||||||||||||||||||||||||||||||
441E-414 632 CGCCGTGCTTGCTTGAAGCGTGTGAGTCGTGTGTGCGCTACGATCGTGTC 681
441E-414 751 ATGGTGCTAGTGGTTTTGCGTAATCGTGATGTTGNAATAAAGTGAGTGAA 800
|||||||||||||||||||||||||||||||||| |||||||||||||||
441E-414 682 ATGGTGCTAGTGGTTTTGCGTAATCGTGATGTTGNAATAAAGTGAGTGAA 731
441E-414 801 CAGACATTCATGCCCCAAGTATATGAAAAANAAANCAANAAAACTTCGAG 850
|||||||||||||||||||||||||||||| ||| ||| ||||||
441E-414 732 CAGACATTCATGCCCCAAGTATATGAAAAANAAANCAANAAAACT 776
441E-414 851 GGGGGGGCCCGGTACCCAATTTCGCCCTATAAGGAGTCGTATTAACAATT 900
441E-414 777 776
441E-414 901 CCCC 904
441E-414 777 776
#---------------------------------------
#---------------------------------------
GTGGATTCCCCGCGGTGGCGGCGCTCTAGAACTAGTGGGATCCCCCGGGCTGCAGGAATTCGGCACGAGGGCGGACCCCA
CTTCGACGTGGCTCTGGGCCGACGTGACGGGCTGGCCCCAGCGTTGGAGGATCTCGTCTCCACCCTACCGGCGCCCTCCT
TCACCGTGCCGGAACTCCTCAAGTCTTTCGGCGACCGAAACCTCGACAAGGCGGACCTGGTGTCCCTCTCTGGCGCGCAC
TCCTTCGGCATCGCCCACTGCTCCTCCTTCTCCGACCGCTTCACGCCGGTCGACGACACCGACCTAGTCATCGACCCCAA
TTTCGCGGCCAAGTTGAGGGCCAAGTGTGCTAAGGACATGCCTGCGGGCACCGTCAACCAGACCCTCGATTTGCGTACGC
CGGACGTGTTCGACAACAAGTACTACTTTGATCTCATTGCCAAGCAGGGTCTGTTCAAGTCGGACCAGGGCCTCATCGTC
CACCCCAACACCACGCGCATGGCGACGCGGTTCTCGCTCAACCAGGGGGCATTCTTCGAGCAGTTCGCCAAATCCATGGT
GAAGATGAGCAACATGGACTTGCTCACCGGCAGCCAGGGCGAGATCCGGTTCAACTGCGCCGTCCCCAACAGCCGTGTCA
AGGGCATCGAGACCGCCAGCGACGAGGGCCATGCCGCCGCCATGTAAGAGATTGGTTAGTCGCCGTGCTTGCTTGAAGCG
TGTGAGTCGTGTGTGCGCTACGATCGTGTCATGGTGCTAGTGGTTTTGCGTAATCGTGATGTTGNAATAAAGTGAGTGAA
CAGACATTCATGCCCCAAGTATATGAAAAANAAANCAANAAAACTTCGAGGGGGGGGCCCGGTACCCAATTTCGCCCTAT
AAGGAGTCGTATTAACAATTCCCC
ATC 7 4.4
ATG 3 1.2
CCC 5 0.5
GAT 8 1.9
TCC 4 3.6
Strand
sense
anti-sense
sense
sense
sense
sense
anti-sense
ARID1B
ASCC3L1
BDNF
C7orf16
CD74
CDS2
DAPK1
EPB49
ERCC1
HLA-A
HMGB3
LRRC23
MAN2C1
MMP21
RAB9A
RNF152
SUSD1
TMEM45B
TRDN
ZBTB8OS
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment