Commit 972b1bab authored by Lingling Jin (lij313)'s avatar Lingling Jin (lij313)
Browse files

add examples 2022.04.06

parent d7304b32
>gb|CP003137.1|:750-2150 Pediococcus claussenii ATCC BAA-344, complete genome
GGGAATGAAAAAAGTGCCAGATTATAATCAACTTTGGGAACAGATTCGATCGGCTTTCGAAAACGATTCA
AGCATGTCAAAAGCCAGTTACAATGCTTGGGTTGCCGTGGCTAGTCCTGTCTCTCTAAAAAATAAGATAC
TTACTATTAAGGTTCCATCCAGTTTACATAAGGATTATTGGGAGAAACATCTCGCTGAAAAGTTTATTGA
GTATGCTTATCAATTTGCCGACACAGATATTACTCCCGCTTTTGTAATCAAAGATCCTAATGCGCCAGAT
CCAGATAAGGCGCAACAGGCTGCCGAAAAAAAAGAAGAGGATGACACTCAATTAAATAGTCGTTATACAT
TTGATACTTTCGTCACTGGTAGTGGCAATCAAATGGCCCATGCCGCTGCTCTAGCTGTTTCAGAAGATCC
CGGAACTTTGTATAATCCCCTTTTCTTTTATGGTGGTGTTGGACTTGGAAAAACTCATTTAATGCACGCG
ATTGGTCACCAGATTCTCAAAAATAATCCTGATACACGTGTTAAATATGTTACTAGCGAAACTTTTACTA
ACGATTTTATTAATTCACTTCAAAAAAATCGTCAAGATGAATTTCACTCCAAGTACCGCAATGTTGACCT
TTTATTAGTGGATGATGTACAATTTTTTGCTGATAAAGAGGCTACGCAAGAGGAATTTTTCCATACTTTC
GAAGCTCTTTATAACGCTGAGAAACAGATCGTCCTAACTTCGGATCGCATTCCCAATGAAATTCCGAAGT
TACAAGAACGCCTAGTTTCACGTTTTAAATGGGGGCTATCCGTTGATATCACGCCTCCAAATCTCGAAAC
AAGAATTGCTATTCTGCGTGAAAAAGCCATCGCGGACAATGTTGACATTCCAGATGAGACTCTCACATTT
ATTGCAGATCAAGTTGATTCCAATATTCGTGAACTAGAAGGAGCTATGGCGCGGATTCAAGCCTATGCAA
CTTTGCAAAACGCTACTATAACAACCGAGCTTGCTGGCGAAGCACTACGCAGCCTGAGTTTTGGCTCAAA
TTTGGCACACGTTTCTATTGCCCTCATTCAGAGTAAGGTTGCTGACTATTTCCATGTTACTGTCTCTGAC
TTAAAAGGTAAAAAACGAGTAAAATCAATCGTAACACCACGTCAAATCGCGATGTACCTTGCACGCGATC
TAACCGATAACTCACTTCCGCAAATTGGAACTGAATTCGGCGGCAAAGATCATACAACGGTAATTCATGC
TTACGAAAAAGTAAAAGATGACCTTGAAAATGACGAAGATTTGCAACGTCAAATTGGGGATTTGAAAAGT
GAGTTAAAAGCTTAATTTGTGGATAAATGTTAATAACTACTAAAAGTTATCCACAAGTTATCCACAAGGA
T
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment