Commit 37c80916 authored by Lingling Jin (lij313)'s avatar Lingling Jin (lij313)
Browse files

add example files 2022.02.14

parent c8d5b177
>441E-414
GGCGGACCCCACTTCGACGTGGCTCTGGGCCGACGTGACGGGCTGGCCCCAGCGTTGGAG
GATCTCGTCTCCACCCTACCGGCGCCCTCCTTCACCGTGCCGGAACTCCTCAAGTCTTTC
GGCGACCGAAACCTCGACAAGGCGGACCTGGTGTCCCTCTCTGGCGCGCACTCCTTCGGC
ATCGCCCACTGCTCCTCCTTCTCCGACCGCTTCACGCCGGTCGACGACACCGACCTAGTC
ATCGACCCCAATTTCGCGGCCAAGTTGAGGGCCAAGTGTGCTAAGGACATGCCTGCGGGC
ACCGTCAACCAGACCCTCGATTTGCGTACGCCGGACGTGTTCGACAACAAGTACTACTTT
GATCTCATTGCCAAGCAGGGTCTGTTCAAGTCGGACCAGGGCCTCATCGTCCACCCCAAC
ACCACGCGCATGGCGACGCGGTTCTCGCTCAACCAGGGGGCATTCTTCGAGCAGTTCGCC
AAATCCATGGTGAAGATGAGCAACATGGACTTGCTCACCGGCAGCCAGGGCGAGATCCGG
TTCAACTGCGCCGTCCCCAACAGCCGTGTCAAGGGCATCGAGACCGCCAGCGACGAGGGC
CATGCCGCCGCCATGTAAGAGATTGGTTAGTCGCCGTGCTTGCTTGAAGCGTGTGAGTCG
TGTGTGCGCTACGATCGTGTCATGGTGCTAGTGGTTTTGCGTAATCGTGATGTTGNAATA
AAGTGAGTGAACAGACATTCATGCCCCAAGTATATG
>441E-590 441E-590.SEQ trimmed vector-stripped
GCGTCGACGTTCTACGACACGTCGTGCCCCAGGGCTCTGGCCACCATCAAGAGCGGCGTG
GCGGCAGCCGTGAGCAGCGATCCCCGCATGGGCGCCTCCCTGCTCAGGCTGCACTTCCAC
GACTGCTTTGTCCAAGGCTGTGACGCGTCTGTTCTTCTGTCCGGCATGGAACAAAACGCG
GGTCCGAACGTGGGGTCGCTGAGGGGCTTCGGCGTCATCGACAACATCAAGACCCAGCTG
GAGAGTATATGCAAGCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCCGCCCGCGAC
TCCGTTGTCGCCCTTGGAGGGCCATCGTGGACTGTCCCGCTGGGGAGACGGGACTCCACC
ACCGCAAGTGCCTCGCTGGCGAACAGTGACCTCCCTGGCCCGAGCTCTAGCCGGTCACAG
CTCGAGGCCGCGTTCCTCAAGAAGAACCTTAACACGGTCGACATGGTCGCGCTCTCAGGC
GCGCACCACATCGGGAAGNCCAGTGCTCCAACTTTCGGACTCGGATCTACGGGGGTGACA
ACAACATCAAACACTGGCTTCCGACGTCTCTCAAGGNCAAACTGCCCCCCAGTCCCGGGG
GGCAAACAACCAAACCTTGGNCGNAACCNTGGGAACACNNANCGAACGCCCCCAAANGGC
GTTTTCNGAACAAAACGGCCCTTNACTTNCAACCCAAAACCCTTCCCTTGGTCAACAAAA
AAAAAANGGGGGNTTCCCCTTGGGNAACTTCGNGGAAANCCAAANGGNGGGGTTTCTTTT
AAAAACAAAC
>441E-1197
GCACCACTCCACCAGTAAAGAAGTGCAGGCAACTAGCTAGCTAACCATGGCCGCCTCTGC
CTCTTGCATTTCACTGGTGGTGCTCGTGGCTCTGGCCACGGTGGCGTCGGCGCAGCTGTC
GCCGACGTTCTACGACACGTCGTGCCCCAGGGCCCTGGCCACCATCAAGAGCGGCGTCAT
GGCCGCCGTGAGCAGCGACCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGA
CTGCTTCGTCCAAGGCTGTGACGCGTCTGTTCTGCTGTCTGGCATGGAACAAAACGCTCT
CCCGAACAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGA
GGCCATCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACTC
CGTCGTCGCCCTCGGAGGGCCATCATGGACAGTCCCTCTGGGAAGAAGGGATTCCATANA
TGNAAACGAGGNGGTGGCAAACAGCGACTCCCAGCCCTACGTCTAGCCGTTCAGATCTTG
AG
This diff is collapsed.
This diff is collapsed.
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment